Jump straight to content - Accessibility Information and Accesskeys.

Results from the ResistVir database
Genetic resistances to plant viruses and their vectors

Information about JIC
John Innes Centre - BBSRC
Norwich - United Kingdom

Last database update for these data: 2006-12-04 - Data extracted on 2009-04-14 from the database.

Tools and resources

Germplasm assessments   Collections   Plant resources   Virus resources   Markers
Germplam assessments
No Germplasm collection                         Title                         Period                         Description                                        Recordable data Key words Viruses Vectors Host plants Crops Genetic resistances
1 JIC collection: Doubled haploid and F2 population of Hordeum vulgare Igri x Triumph Analysis of susceptibility to Maize streak virus 2002 - 2006 Segregating populations for MSV resistance Yes barley
Doubled haploid
Resistance
MSV
Maize streak virus Hordeum vulgare Barley HvMsv-1 - barley
Collections
No Category Name of collection                    Persons to contact                    Description                                                       Address                           Postal code                          City                          Country                          Phone                          Email                          Plants                          Size                          Viruses                          Size                         
1 Plants JIC collection: Doubled haploid and F2 population of Hordeum vulgare Igri x Triumph Margaret Irene Boulton John Innes Centre, Colney Lane NR4 7UH Norwich United Kingdom 44 16 03 45 02 67 margaret.boulton@bbsrc.ac.uk Hordeum vulgare 94 Dh lines, 250 F2 families.
2 Viruses Maize streak virus Margaret Irene Boulton JIC collection: Infectious clones of several MSV isolates are available John Innes Centre, Colney Lane NR4 7UH Norwich United Kingdom 44 16 03 45 02 67 margaret.boulton@bbsrc.ac.uk Maize streak virus 5
3 Viruses JIC collection: Wheat dwarf virus Margaret Irene Boulton Infectious clone of the Czech isolate of Wheat dwarf virus John Innes Centre, Colney Lane NR4 7UH Norwich United Kingdom 44 16 03 45 02 67 margaret.boulton@bbsrc.ac.uk Wheat dwarf virus 1
Plant resources
No Resource names Plant species Resource type Description                                        Availability                           Viruses Vectors Crops Genetic resistances
1 Pea line JI1405 Pisum sativum Line Pea germplasm collection held at John Innes Centre
Pea lines JI1405, JI2009, 835, 744, and PI269818 characterised for eIF4E variation in connection with susceptibility to PSbMV
Resistances: sbm-1 and sbm-4
Yes Pea seed-borne mosaic virus Myzus persicae Peas sbm-1 - Pisum sativum
2 Pea line JI2009 Pisum sativum Line Pea germplasm collection held at John Innes Centre
Pea lines JI1405, JI2009, 835, 744, and PI269818 characterised for eIF4E variation in connection with susceptibility to PSbMV
Resistances: sbm-1 and sbm-4
Yes Pea seed-borne mosaic virus Myzus persicae Peas sbm-1 - Pisum sativum
3 Pea line 835 Pisum sativum Line Pea germplasm collection held at John Innes Centre
Pea lines JI1405, JI2009, 835, 744, and PI269818 characterised for eIF4E variation in connection with susceptibility to PSbMV
Resistances: sbm-1 and sbm-4
Yes Pea seed-borne mosaic virus Myzus persicae Peas sbm-1 - Pisum sativum
4 Pea line 744 Pisum sativum Line Pea germplasm collection held at John Innes Centre
Pea lines JI1405, JI2009, 835, 744, and PI269818 characterised for eIF4E variation in connection with susceptibility to PSbMV
Resistances: sbm-1 and sbm-4
Yes Pea seed-borne mosaic virus Myzus persicae Peas sbm-1 - Pisum sativum
5 Pea line PI269818 Pisum sativum Line Pea germplasm collection held at John Innes Centre
Pea lines JI1405, JI2009, 835, 744, and PI269818 characterised for eIF4E variation in connection with susceptibility to PSbMV
Resistances: sbm-1 and sbm-4
Yes Pea seed-borne mosaic virus Myzus persicae Peas sbm-1 - Pisum sativum
Virus resources
No Resource names Virus species Resource type Original plant host Laboratory plant host Country of origin Year of isolation Details about origin                        Comments                           Key words Host plants Crops Genetic resistances
1 Maize streak virus mutants Maize streak virus Mutant Zea mays Zea mays Nigeria 1984 Severe and mild isolates isolated from a single infected maize plant Multimeric genome constructs in pBIN19, suitable for agroinoculation Maize streak virus
infectious clone
agroinoculation
Zea mays
Oryza sativa
Triticum aestivum
Hordeum vulgare
Maize
Rice
Wheat
Barley
HvMsv-1 - barley
Markers
No Marker names Marker type Method description                                     Primers Primers sequences Viruses Host plants Crops Genetic resistances
1 4Egenomic - Pisum sativum PCR specific We have identified sequences derived from the genes for the eukaryotic translation initiation factors eIF4E and eIF(iso)4E as being very tightly linked to the resistance gene clusters on linkage groups VI and II, respectively. In particular, no recombinants between sbm-1 and eIF4E were found amongst 500 individuals of a F2 cross between the BC4 resistant line (JI1405) and its recurrent susceptible parent ‘ScoutÂ’. 4Egenomic5'
4Egenomic3'
GAGCTAGATGGTTGTTATGATGTTTATCAG
ATTCTCGATCACACTAGCCCCCCTCC
Pea seed-borne mosaic virus Pisum sativum Peas sbm-1 - Pisum sativum